TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses

Victor N. Rivas, Monica Aleman, Janel A. Peterson, Anna R. Dahlgren, Erin N. Hales, Carrie J. Finno

Research output: Contribution to journalArticle

Abstract

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed.

Original languageEnglish (US)
JournalGenes
Volume10
Issue number10
DOIs
StatePublished - Oct 16 2019

Fingerprint

Ribonucleases
Horses
Epilepsy
Electroencephalography
Base Pairing
Introns
Seizures
Genes

Keywords

  • convulsion
  • electroencephalogram
  • equine
  • seizure

ASJC Scopus subject areas

  • Genetics
  • Genetics(clinical)

Cite this

TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses. / Rivas, Victor N.; Aleman, Monica; Peterson, Janel A.; Dahlgren, Anna R.; Hales, Erin N.; Finno, Carrie J.

In: Genes, Vol. 10, No. 10, 16.10.2019.

Research output: Contribution to journalArticle

Rivas, Victor N. ; Aleman, Monica ; Peterson, Janel A. ; Dahlgren, Anna R. ; Hales, Erin N. ; Finno, Carrie J. / TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses. In: Genes. 2019 ; Vol. 10, No. 10.
@article{fd078d11e7834f63a11fd4e070f6a3b9,
title = "TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses",
abstract = "Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed.",
keywords = "convulsion, electroencephalogram, equine, seizure",
author = "Rivas, {Victor N.} and Monica Aleman and Peterson, {Janel A.} and Dahlgren, {Anna R.} and Hales, {Erin N.} and Finno, {Carrie J.}",
year = "2019",
month = "10",
day = "16",
doi = "10.3390/genes10100816",
language = "English (US)",
volume = "10",
journal = "Genes",
issn = "2073-4425",
publisher = "Multidisciplinary Digital Publishing Institute (MDPI)",
number = "10",

}

TY - JOUR

T1 - TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses

AU - Rivas, Victor N.

AU - Aleman, Monica

AU - Peterson, Janel A.

AU - Dahlgren, Anna R.

AU - Hales, Erin N.

AU - Finno, Carrie J.

PY - 2019/10/16

Y1 - 2019/10/16

N2 - Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed.

AB - Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed.

KW - convulsion

KW - electroencephalogram

KW - equine

KW - seizure

UR - http://www.scopus.com/inward/record.url?scp=85073615070&partnerID=8YFLogxK

UR - http://www.scopus.com/inward/citedby.url?scp=85073615070&partnerID=8YFLogxK

U2 - 10.3390/genes10100816

DO - 10.3390/genes10100816

M3 - Article

C2 - 31623255

AN - SCOPUS:85073615070

VL - 10

JO - Genes

JF - Genes

SN - 2073-4425

IS - 10

ER -